This page lists an overview of the coverage and additional information for SSU primers and primer pairs. The coverage information can be viewed either as “% in Species” or “% in Sequences”. Specific terms are defined as follows:
Length = The primer length, measured in base pairs
Coverage % in Sequences = The percent of sequences covered within this taxon, considering four conditions: (1) all three domains (All), (2) Bacteria only (Bacterial %), (3) Archaea only (Archaeal %), or (4) Eukaryota only (Eukaryotic %). It’s calculated with the equation {number of sequences within this taxon that can be amplified using the specified primer pair} / {total number of sequences in the database* from this taxa}
Coverage % in Species = The percent of species covered within this taxon, considering four conditions: (1) all three domains (All), (2) Bacteria only (Bacterial %), (3) Archaea only (Archaeal %), or (4) Eukaryota only (Eukaryotic %). It’s calculated with the equation {number of species within this taxon that produce at least one amplicon using the specified primer pair} / {total number of species in the database* from this taxa}
Amplicon Length = The average length of all amplicon sequences produced by the specific primer pair
| DSPN name | Long name | Sequence | Length | All% | Bacterial% | Archaeal% | Eukaryotic% | Amplicon Length | Melting temperature | Dimer formation | GC content |
|---|---|---|---|---|---|---|---|---|---|---|---|
| SU906ar | S-*-Univ-0906-a-A-17 | CAATTCMTTTAAGTTTC | 17 | 0.547856 | 0.390674 | 0.976629 | 0.976131 | - | 33 | 33 | 23.53 |
| SU906af-SU1525ar | S-*-Univ-0906-a-S-17 S-*-Univ-1525-a-A-17 |
GAAACTTAAAKGAATTG WAGGAGGTRATCCADCC | 17 17 | 0.111906 | 0.147054 | 0.198908 | 4.5E-5 | 602.331830275172 | 33 37 | 33 37 | 23.53 47.06 |
| SU906af-SU1492fr | S-*-Univ-0906-a-S-17 S-*-Univ-1492-a-A-19 |
GAAACTTAAAKGAATTG ACGGCTACCTTGTTACGACTT | 17 19 | 0.388996 | 0.365276 | 0.392187 | 0.45904 | 577.782063512695 | 33 55 | 33 55 | 23.53 47.62 |
| SU906af-SU1492cr | S-*-Univ-0906-a-S-17 S-*-Univ-1492-a-A-21 |
GAAACTTAAAKGAATTG GGTTACCTTGTTACGACTT | 17 21 | 0.400542 | 0.376304 | 0.413681 | 0.471244 | 577.667679742338 | 33 47 | 33 47 | 23.53 42.11 |
| SU906af-SU1392ar | S-*-Univ-0906-a-S-17 S-*-Univ-1392-a-A-15 |
GAAACTTAAAKGAATTG ACGGGCGGTGTGTRC | 17 15 | 0.889979 | 0.886228 | 0.702661 | 0.917584 | 472.322240515248 | 33 41 | 33 41 | 23.53 66.67 |
| SU906af-SU1390ar | S-*-Univ-0906-a-S-17 S-*-Univ-1390-a-A-18 |
GAAACTTAAAKGAATTG GACGGGCGGTGTGTACAA | 17 18 | 0.886108 | 0.882937 | 0.672467 | 0.914311 | 470.15770001705 | 33 51 | 33 51 | 23.53 61.11 |
| SU906af-SU1100ar | S-*-Univ-0906-a-S-17 S-*-Univ-1100-a-A-15 |
GAAACTTAAAKGAATTG GGGTYKCGCTCGTTR | 17 15 | 0.942345 | 0.955011 | 0.833163 | 0.914401 | 177.057452865872 | 33 33 | 33 33 | 23.53 53.33 |
| SU906af-SU1053ar | S-*-Univ-0906-a-S-17 S-*-Univ-1053-a-A-16 |
GAAACTTAAAKGAATTG CTGACGRCRGCCATGC | 17 16 | 0.719121 | 0.956231 | 0.856875 | 0.00402324 | 130.278800679792 | 33 41 | 33 41 | 23.53 62.50 |
| SU906af-SN1492dr | S-*-Univ-0906-a-S-17 S-P-Nano-1492-a-A-21 |
GAAACTTAAAKGAATTG ACGGCTACCTTGTGTCGACTT | 17 21 | 0.19136 | 0.24997 | 0.301774 | 0.00788134 | 570.246339109405 | 33 57 | 33 57 | 23.53 52.38 |
| SU906af-SN1390dr | S-*-Univ-0906-a-S-17 S-P-Nano-1390-a-A-17 |
GAAACTTAAAKGAATTG ACGGGCGGTGAGTGCAA | 17 17 | 0.0280182 | 0.0172716 | 0.675879 | 0.00286731 | 467.328616858165 | 33 49 | 33 49 | 23.53 64.71 |