Primer coverage

SSU区域的引物覆盖情况

This page lists an overview of the coverage and additional information for SSU primers and primer pairs. The coverage information can be viewed either as “% in Species” or “% in Sequences”. Specific terms are defined as follows:


  • Length = The primer length, measured in base pairs

  • Coverage % in Sequences = The percent of sequences covered within this taxon, considering four conditions: (1) all three domains (All), (2) Bacteria only (Bacterial %), (3) Archaea only (Archaeal %), or (4) Eukaryota only (Eukaryotic %). It’s calculated with the equation {number of sequences within this taxon that can be amplified using the specified primer pair} / {total number of sequences in the database* from this taxa}


  • Coverage % in Species = The percent of species covered within this taxon, considering four conditions: (1) all three domains (All), (2) Bacteria only (Bacterial %), (3) Archaea only (Archaeal %), or (4) Eukaryota only (Eukaryotic %). It’s calculated with the equation {number of species within this taxon that produce at least one amplicon using the specified primer pair} / {total number of species in the database* from this taxa}


  • Amplicon Length = The average length of all amplicon sequences produced by the specific primer pair

Reset
Filtering Results: Data Download
A total of 5934 records,Page 10,each page Results
DSPN name Long name Sequence Length All% Bacterial% Archaeal% Eukaryotic% Amplicon Length Melting temperature Dimer formation GC content
SU906ar S-*-Univ-0906-a-A-17 CAATTCMTTTAAGTTTC 17 0.547856 0.390674 0.976629 0.976131 - 33 33 23.53
SU906af-SU1525ar S-*-Univ-0906-a-S-17
S-*-Univ-1525-a-A-17
GAAACTTAAAKGAATTG WAGGAGGTRATCCADCC 17 17 0.111906 0.147054 0.198908 4.5E-5 602.331830275172 33 37 33 37 23.53 47.06
SU906af-SU1492fr S-*-Univ-0906-a-S-17
S-*-Univ-1492-a-A-19
GAAACTTAAAKGAATTG ACGGCTACCTTGTTACGACTT 17 19 0.388996 0.365276 0.392187 0.45904 577.782063512695 33 55 33 55 23.53 47.62
SU906af-SU1492cr S-*-Univ-0906-a-S-17
S-*-Univ-1492-a-A-21
GAAACTTAAAKGAATTG GGTTACCTTGTTACGACTT 17 21 0.400542 0.376304 0.413681 0.471244 577.667679742338 33 47 33 47 23.53 42.11
SU906af-SU1392ar S-*-Univ-0906-a-S-17
S-*-Univ-1392-a-A-15
GAAACTTAAAKGAATTG ACGGGCGGTGTGTRC 17 15 0.889979 0.886228 0.702661 0.917584 472.322240515248 33 41 33 41 23.53 66.67
SU906af-SU1390ar S-*-Univ-0906-a-S-17
S-*-Univ-1390-a-A-18
GAAACTTAAAKGAATTG GACGGGCGGTGTGTACAA 17 18 0.886108 0.882937 0.672467 0.914311 470.15770001705 33 51 33 51 23.53 61.11
SU906af-SU1100ar S-*-Univ-0906-a-S-17
S-*-Univ-1100-a-A-15
GAAACTTAAAKGAATTG GGGTYKCGCTCGTTR 17 15 0.942345 0.955011 0.833163 0.914401 177.057452865872 33 33 33 33 23.53 53.33
SU906af-SU1053ar S-*-Univ-0906-a-S-17
S-*-Univ-1053-a-A-16
GAAACTTAAAKGAATTG CTGACGRCRGCCATGC 17 16 0.719121 0.956231 0.856875 0.00402324 130.278800679792 33 41 33 41 23.53 62.50
SU906af-SN1492dr S-*-Univ-0906-a-S-17
S-P-Nano-1492-a-A-21
GAAACTTAAAKGAATTG ACGGCTACCTTGTGTCGACTT 17 21 0.19136 0.24997 0.301774 0.00788134 570.246339109405 33 57 33 57 23.53 52.38
SU906af-SN1390dr S-*-Univ-0906-a-S-17
S-P-Nano-1390-a-A-17
GAAACTTAAAKGAATTG ACGGGCGGTGAGTGCAA 17 17 0.0280182 0.0172716 0.675879 0.00286731 467.328616858165 33 49 33 49 23.53 64.71