This page lists an overview of the coverage and additional information for ITS primers and primer pairs. The coverage information can be viewed either as “% in Species” or “% in Sequences”. Specific terms are defined as follows:
Length = The primer length, measured in base pairs
Coverage % in Sequences = The percent of sequences covered within the fungi kingdom. It’s calculated with the equation {number of fungal sequences that can be amplified using the specified primer pair} / {total number of sequences in the database*}
Coverage % in Species = The percent of species covered within the fungi kingdom. It’s calculated with the equation {number of fungal species that produce at least one amplicon using the specified primer pair} / {total number of species in the database*}
Amplicon Length = The average length of all amplicon sequences produced by the specific primer pair
| DSPN name | Long name | Sequence | Length | Fungal% | Amplicon Length | Melting temperature | Dimer formation | GC content |
|---|---|---|---|---|---|---|---|---|
| IU3662ar | LR7 | TACTACCACCAAGATCT | 17 | 0.989474 | - | 41 | - | 41.18 |
| IU3355ar | LR6 | CGCCAGTTCTGCTTACC | 17 | 0.97193 | - | 47 | - | 58.82 |
| IU3179ar | TW14 | GCTATCCTGAGGGAAACTTC | 20 | 0.974561 | - | 53 | - | 50.00 |
| IU3178ar | LR5 | TCCTGAGGGAAACTTCG | 17 | 0.969298 | - | 45 | - | 52.94 |
| IU2870af-IU3662ar | LR3R LR7 |
GTCTTGAAACACGGACC TACTACCACCAAGATCT | 17 17 | 0.962281 | 783.648234510326 | 45 41 | FALSE | 52.94 41.18 |
| IU2870af-IU3355ar | LR3R LR6 |
GTCTTGAAACACGGACC CGCCAGTTCTGCTTACC | 17 17 | 0.959649 | 476.970119521912 | 45 47 | FALSE | 52.94 58.82 |
| IU2870af-IU3179ar | LR3R TW14 |
GTCTTGAAACACGGACC GCTATCCTGAGGGAAACTTC | 17 20 | 0.963158 | 300.428855062872 | 45 53 | FALSE | 52.94 50.00 |
| IU2870af-IU3178ar | LR3R LR5 |
GTCTTGAAACACGGACC TCCTGAGGGAAACTTCG | 17 17 | 0.958772 | 299.391362126246 | 45 45 | FALSE | 52.94 52.94 |
| IU2870af-IE3433ar | LR3R nLSU1221r |
GTCTTGAAACACGGACC CTAGATGAACYAACACCTT | 17 19 | 0.831579 | 554.594346829641 | 45 43 | FALSE | 52.94 36.84 |
| IU2870af-IE3101ar | LR3R LR5-Fung |
GTCTTGAAACACGGACC CGATCGATTTGCACGTCAGA | 17 20 | 0.961403 | 214.275679257787 | 45 53 | FALSE | 52.94 50.00 |
